521–530 of 570 posts
Earlier quoted context omitted.
Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.
TIL my years of perl regex'ing was preparing me for a future of DNA gene warfare (core war, anybody?)
> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene. They also carry a molecular GPS — CRISPR — which was altered to crawl along a person’s DNA until it finds the exact DNA letter that needs to be c…
One other fun part of gene editing in vivo is that we don't actually use GACU (T in DNA). It turns out that if you use Pseudouridine (Ψ) instead of uridine (U) then the body's immune system doesn't nearly alarm as much, as it doesn't really see that mRNA as quite so dangerous. But , the RNA -> Protein equipment will just make protiens it without any problems. Which, yeah, that's a miraculous discovery. And it was wel…
Earlier quoted context omitted.
The “How to make superbabies” article demonstrates a couple of fundamental misunderstandings about genetics that make me think the authors don’t know what they’re talking about at a basic level. Zero mention of linkage disequilibrium. Zero mention of epistasis. Unquestioned assumptions of linear genotype-phenotype relationships for IQ. Seriously, the projections in their graphs into “danger zone” made me laugh out lo…
The EA community is generally incapable of self-awareness. The academic-but-totally-misinformed tone is comparable to reading LLM output. I've stopped trying to correct them, it's too much work on my part and not enough on theirs.
Earlier quoted context omitted.
What do you mean “if they were really effective”? We still hand out CBRN gear and train in how to put necessary parts on in seconds, because that’s often how little time you get before you’re permanently incapacitated. Mustard gas alone should prove this, and that’s an OLD chemical weapon. Nowadays we have riot control agents that can be tailored to demographics, react more violently in the presence of sweat, or cont…
I'd encourage you to read the article. Chemical weapons are effectively useless against a well-trained "modern system" army. Part of that is the chemical warfare equipment and vehicles, but mostly it's cover-and-concealment. If you can actually find the enemy, it's much faster and simpler to use the other vastly destructive munitions that modern militaries have.
Additionally, that “if you can find them” is doing some pretty heavy lifting. The range of explosives and kinetics is hilariously low, and the actual percentage of your military with the level of mobility he seems to be referring to is infinitesimal.
This argument more correctly explains why chemical weapons aren’t a great defense against precision strike groups. It also doesn’t get into detail with concepts like dropping a bomb right in the middle of a firefight knowing it literally cannot harm your own troops, short of the physical metal accidentally falling on one of your own troops.
Earlier quoted context omitted.
No they were not. A vaccine triggers an immune response, not a functional change. mRNA vaccines are highly localized: you get a sore arm because most of it only gets taken up by muscle cells around the injection site, which spend some time producing the antigen and triggering a primary immune response (the inflammation aka the sore arm).
What I find interesting about the covid mRNA vaccine is I remember being sick in March 2020 and I can't remember being sick since. I can remember getting a sniffle at night and waking up fine the next morning a few times. I think I had two doses of covid mRNA vaccine. I have actually forgot what it is like to be sick. It almost feels like the covid vaccine gave me some kind of super immunity. I never get the flu shot…
[flagged]
Please observe the guidelines, especially these ones:
Be kind. Don't be snarky. Converse curiously; don't cross-examine. Edit out swipes.
Comments should get more thoughtful and substantive, not less, as a topic gets more divisive.
Please don't fulminate. Please don't sneer, including at the rest of the community.
Please respond to the strongest plausible interpretation of what someone says, not a weaker one that's easier to criticize. Assume good faith.
Eschew flamebait. Avoid generic tangents. Omit internet tropes.
Please don't use Hacker News for political or ideological battle. It tramples curiosity.
[flagged]
Please observe the guidelines, especially these ones:
Be kind. Don't be snarky. Converse curiously; don't cross-examine. Edit out swipes.
Comments should get more thoughtful and substantive, not less, as a topic gets more divisive.
Please don't fulminate. Please don't sneer, including at the rest of the community.
Please respond to the strongest plausible interpretation of what someone says, not a weaker one that's easier to criticize. Assume good faith.
Eschew flamebait. Avoid generic tangents. Omit internet tropes.
Please don't use Hacker News for political or ideological battle. It tramples curiosity.
[flagged]
[flagged]
[flagged]