Hacker News Board Hacker News, browsed like a classic message board
Live data from Hacker News

Baby is healed with first personalized gene-editing treatment

nytimes.com

Post reply on HN
Print view View original

321–330 of 570 posts

Re: Baby is healed with first personalized gene-editing treatment

#321

Post by SubiculumCode »

dekhn wrote: post #76
caycep wrote: post #57

Earlier quoted context omitted.

I want to say, maybe it's better to say first human under proper IRB/regulatory compliance. Some rogue academic in China tried it a few years ago, if I recall, but with absolutely no oversight and he was pilloried. Also I don't think there is much details about what he actually did... https://www.npr.org/2023/06/08/1178695152/china-scientist-he...

What the Chinese guy (He) did was completely different. He permanently altered the germline in embryos, which means that every cell in the resulting baby is transformed permanently with the change he made. The work he did violated a wide range of good practice (specifically, the change he made didn't actually work for the goal he desired, and he also ignored all the ethical advice around this experiment, and avoided…

Do new liver cells always come from stem cells, not from dividing liver cells? Are those heppatocyte stem cells reside in the liver, or do they travel their via migration,.or blood, etc?

A quick search suggests that liver regen involves dividing mature liver cells to replace turnover. If so, I'd suspect that they'd continue to carry the.crispr edit forward.

Re: Baby is healed with first personalized gene-editing treatment

#322

Post by palisade »

Does this mean when they grow up, their own offspring will also have this defect and require a correction? And, if so, does this mean it is now introducing this defective gene into our gene pool?

I know this is an issue with caesarean section. It is becoming more prevalent because those who require it are surviving, making it more likely to happen in their offspring.

Re: Baby is healed with first personalized gene-editing treatment

#323

Post by kjkjadksj »

Honestly the biggest barriers to a lot of advancement right now in biology from medicine to our food supply depend squarely on getting uneducated people over their aversions to modern science. It is crazy. We are really at the “I don’t trust that locomotive/airplane/car” stage where what the public understands about the field is so far away from the state of the art and the risk considerations that have been put in place by the actual domain experts who have thought of all your concerns already. It isn’t just lay people either but government officials in charge or permitting and approvals that need the most convincing. They might be out of the field themselves for a decade or more.

Re: Baby is healed with first personalized gene-editing treatment

#324

Post by zharknado »

bglazer wrote: post #296
burnt-resistor wrote: post #252

Hmm, I thought clinical gene editing (gene therapy) was frowned upon because it's inherently risky and fraught with ethical hazards. What technically and ethically has changed since 2005 beyond CRISPR?

Germline gene editing is still considered risky and unethical. That is, editing cells that form eggs and sperm, thus changing the genome of some of the descendants of the edited person. This is somatic editing. These edits will not be inherited. Somatic editing is becoming more common (see Casgevy) but there are technical hurdles that prevent its application to many cases.

> This is somatic editing. These edits will not be inherited.

Genuine question- how do we know that? Is it just that the edits are very improbable to accumulate in the gonads in sufficient quantities to persist? We can’t actually prevent some fraction of them from reaching other parts of the body, right?

Re: Baby is healed with first personalized gene-editing treatment

#325

Post by kjkjadksj »

tuna-piano wrote: post #224

If someone in the year 2050 was to pick out the most important news article from 2025, I won't be surprised if they choose this one. For those who don't understand this stuff - we are now capable of editing some of a body's DNA in ways that predictably change their attributes. The baby's liver now has different (and better) DNA than the rest of its body. We still are struggling in most cases with how to deliver the D…

Easiest way to do this stuff is before fertilization when you have one egg and one sperm to work with. Delivering change through a multicellular organism is very challenging. All this stuff like transgenic mice are set up in mutant crosses before this stage, before mating really.

Eventually this will be the outcome of our species to edit the gametes themselves. The issue to overcome for this again won’t be technological as that is pretty much solved but getting people over their own “ick” factor.

Re: Baby is healed with first personalized gene-editing treatment

#326

Post by kjkjadksj »

fendy3002 wrote: post #259
tuna-piano wrote: post #224

If someone in the year 2050 was to pick out the most important news article from 2025, I won't be surprised if they choose this one. For those who don't understand this stuff - we are now capable of editing some of a body's DNA in ways that predictably change their attributes. The baby's liver now has different (and better) DNA than the rest of its body. We still are struggling in most cases with how to deliver the D…

the usual next questions will be: - how further can we push this to make the best, most optimized human? - what are moral implication of this? - what are the side effects / downsides?

Low hanging fruit is very low hanging in this case. There are many point mutations for example that confer risk to disease and cancer. Lynch syndrome which confers significant risk for colorectal cancer for example is something that could he cured with transgenic humans today even with todays technology. Just a matter of screening gametes for the mutation (usually one base in the case of Lynch in heterozygous state with wild type healthy allele and that wild type healthy allele gets a second hit mutation as the cancer develops and things just go off the rails from there) and editing that base back to wildtype. No downside only upside with that.

What gets harder are polygenic traits that even today we don’t have great data on what are the causal alleles. But that is also not a technological limitation either but a statistical one from insufficient sampling of these polygenic phenotypes.

Re: Baby is healed with first personalized gene-editing treatment

#327

Post by xarope »

fwip wrote: post #64
poyu wrote: post #31

Earlier quoted context omitted.

Made it sound like it's a computer, is it Turing complete?

Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.

TIL my years of perl regex'ing was preparing me for a future of DNA gene warfare

(core war, anybody?)

Re: Baby is healed with first personalized gene-editing treatment

#328

Post by mondaygreens »

palisade wrote: post #322

Does this mean when they grow up, their own offspring will also have this defect and require a correction? And, if so, does this mean it is now introducing this defective gene into our gene pool? I know this is an issue with caesarean section. It is becoming more prevalent because those who require it are surviving, making it more likely to happen in their offspring.

How can they pass it on when they don't have the defect any more?

Re: Baby is healed with first personalized gene-editing treatment

#329

Post by ziofill »

MrZander wrote: post #11

> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene. They also carry a molecular GPS — CRISPR — which was altered to crawl along a person’s DNA until it finds the exact DNA letter that needs to be c…

A chemist friend of mine did his thesis on lipid vesicles, and I remember my mind being blown when he told me these are modelled as a liquid on the 2D plane of the membrane, but as a solid on the 1D orthogonal direction because the energy to swap two lipid molecules side by side is incredibly low (because it makes barely any difference), while the energy to swap them orthogonally to the membrane is much larger (because they would point in the wrong direction).

Re: Baby is healed with first personalized gene-editing treatment

#330

Post by xarope »

joshmarlow wrote: post #173
poyu wrote: post #31

Earlier quoted context omitted.

Made it sound like it's a computer, is it Turing complete?

If this thread interests you, you should check out "Blood Music" by Greg Bear. It's pretty old but the premise is that a researcher 'closes the loop' in a bunch of cells by making them able to edit their own DNA - thus making them Turing Complete. Hilarity subsequently ensues.

As I get older, I'd be happy with some minor incremental progress on addressing myopia and hyperopia.
Post reply on HN