Smart people can't really understand dumb people. I'm somewhere in between, so I can see that anybody who actually believes this conspiracy theory would never read something like this, so it does not need to be explained.
Is it true? Can Covid-19 vaccines connect me to the internet?
31–40 of 53 posts
Re: Is it true? Can Covid-19 vaccines connect me to the internet?
#32I need some clarification on "connect me to the internet", does that means I can watch Youtube videos by simply closing my eyes? I can search on Google with my thoughts? Can I connect to my smart home so I can turn on the lights without saying a word?
Yes. And if you send ${Your bank balance} to 35hK24tcLEWcgZA4JxpöbkNkoAcJGqQP, I'll decrypt your memory on how to do that as well as all your other favourite memories.
It might help if you root your covid and disable the sort command before the vaccine can install decryption routines.
Reencrypting a memory is hard, right?
Re: Is it true? Can Covid-19 vaccines connect me to the internet?
#33I wrote this thread explaining why this stuff is nonsense https://twitter.com/MoonbaseOtago/status/1370922507146985478
Yeah but that’s exactly what you’d say if you worked for (insert conspiracist bogeyman here)
Re: Is it true? Can Covid-19 vaccines connect me to the internet?
#34Is this true for all of the Covid-19 vaccinations? The page only references the 'Pfizer mRNA vaccine' one. Curiously, does this mean that the Pfizer vaccine is the only one Australia is using/has access to currently?
Actually, Australia will mostly be using the AstraZeneca vaccine, as an Australian manufacturer is licensed to produce it.
It's a good thing too that we have a domestic cabability, as other countries appear to be diverting previously promised doses elsewhere because of Australia's successful covid-19 control programs.
Note: happy to be corrected on any of this. Also, no judgement on the diverting of vaccine doses to more at risk populations, it seems sensible.
Re: Is it true? Can Covid-19 vaccines connect me to the internet?
#35How would a vaccine that can connect you to the internet theoretically work?
Requirements:
* it's a "vaccine" in that it's something introduced into your body to prompt your body to make something else itself
* either you can access some information from the internet or you can be accessed in some way from the internet or both
* assume the patient has a smartphone with data access
Re: Is it true? Can Covid-19 vaccines connect me to the internet?
#36So now you can be on the first page of HN with an April's fool article on April 7th?
Post is dated March 30, I'd say sadly this was probably not intended as an April Fools joke. Unless they're using the 'voltswagen' NTP server :P /lamejoke
Is it showing the date in local Australian time, or translating for your time zone?
Re: Is it true? Can Covid-19 vaccines connect me to the internet?
#37“There is another reason bad ideas continue to live on, which is that people continue to talk about them.
Silence is death for any idea. An idea that is never spoken or written down dies with the person who conceived it. Ideas can only be remembered when they are repeated. They can only be believed when they are repeated.”
James Clear
Re: Is it true? Can Covid-19 vaccines connect me to the internet?
#38Does anyone else have a slight suspicion that this kind of stuff is promoted by authorities as a sort of "nudge"?
The goal, I think, is to emphasise the really wacky stuff so that anyone who might have more nuanced concerns about a vaccine (or anything else that differs from the "correct" narrative) gets lumped in with the crazies, and therefore shamed into keeping quiet.
The UK government, for example, has openly used psyops tactics on its own population for the duration of the pandemic, so I don't think it's too much of a reach to say that this could be another example of it.
> The perceived level of personal threat needs to be increased among those who are complacent, using hard-hitting emotional messaging. From the minutes of SPI-B, the UK government's pandemic psyops group
https://evidencenotfear.com/how-sage-and-uk-media-created-fe...
Compulsory disclaimer that I'm not an anti-vaxxer, I will almost certainly take the vaccine as soon as it's offered to me. I'm just someone who thinks that a government using these fear based tactics on its own people is utterly shameful.
Re: Is it true? Can Covid-19 vaccines connect me to the internet?
#39You say that, why not try TCP/IP-over-RNA?
GCCAGTGAGTGAGTAAGTATATCCACTTACTTGTGTGTGTGTGTACTCGTC GGCTTGTGGGTGAGTGGGCACGCGGACTCGCATGCTTGCTGACTTGTGTGC AGGTGAGCATGCCAATTTGTGCATTGGCGAGGAGGTGTATGAGTGTATCGG GGTGCGTGGCAGCATGGAGAAAAAAAA
Re: Is it true? Can Covid-19 vaccines connect me to the internet?
#40“There is another reason bad ideas continue to live on, which is that people continue to talk about them. Silence is death for any idea. An idea that is never spoken or written down dies with the person who conceived it. Ideas can only be remembered when they are repeated. They can only be believed when they are repeated.” James Clear
you might also like https://slatestarcodex.com/2020/05/28/creationism-unchalleng...