Earlier quoted context omitted.
While not completely equal to the naturally occuring bases, the modified bases in the vaccine mRNA need to be able to complement to the non-modified ones present in tRNA anticodons during translation. If they can pair to their corresponding natural bases, then the chemically modified RNA can be also used as a template by the reverse transcriptase to generate the complementary DNA needed for the sequencing reaction.
Generally I agree, but it could be the case that the modified bases work just well enough for tRNA matching in the ribosome, but not with the reverse transcriptase.
Moderna mRNA sequence released to GitHub [pdf]
311–320 of 389 posts
Re: Moderna mRNA sequence released to GitHub [pdf]
#312Earlier quoted context omitted.
The protein they're trying to manufacture is indeed quite simple - AFAIU both BioNTech and Moderna put together their sequences in a weekend. (Though there was a more involved process of winnowing down the sequences for the most effective ones.) The technically challenging parts are: - delivery mechanism: you need to take a very unstable molecule, protect it from the environment - both external, and when inside the p…
> but testing the thing for safety and efficacy took months What kind of tweaks were made from "the version they threw together in a weekend" to "the version that is in production now"? What's a typical "mRNA" feedback iteration loop like?
Re: Moderna mRNA sequence released to GitHub [pdf]
#313Earlier quoted context omitted.
Reading the primary claim is fascinating: "A composition, comprising: a messenger ribonucleic acid (mRNA) comprising an open reading frame encoding a betacoronavirus (BetaCoV) S protein or S protein subunit formulated in a lipid nanoparticle." I have a "I'm sure that means something to somebody" feeling. It's also surprising that the remaining claims seem to describe the resulting bits of the sequence, and that that…
> I have a "I'm sure that means something to somebody" feeling. Break it down! It's not so bad: > A composition A bunch of stuff > a messenger ribonucleic acid (mRNA) mRNA are cellular instructions on how to make proteins that are read by ribosomes that make those proteins as they read along. > an open reading frame This is something that starts with a "start codon" and ends with an "ending codon" and encodes valid i…
Re: Moderna mRNA sequence released to GitHub [pdf]
#314I do think back to the early days of Covid when there were all these predictions around when a vaccine would show up. It seemed like there was knowledge that the mRNA platform would be the likely solution and probably by April we knew a vaccine would be possible - it just took 6+ months to test.
Thinking about that timeline amazes me.
Re: Moderna mRNA sequence released to GitHub [pdf]
#315The Human Genome Project was completed almost two decades ago, and somebody solved the protein folding problem recently. Why are we still doing genetics at the machine code level? Shouldn't we have some compilers, assemblers and linkers by now?
Take that piece of RNA. An intuitive mental model is that it's some form of "instruction" or a bunch of instruction, isn't it? It's also wrong, because it just encodes a protein that acts the way it does only because of its shape (that is, one of its potential energy local minimums) and the shape of other proteins around it. That shape is only weakly local, it can be affected by far-away sections of peptide sequence. So it's almost impossible to systematically break it down, you have to consider and model things as a whole , which is insanely complex both computationally and cognitively.
If you want a good mental model of how it works, imagine you assemble a thing from metal balls and springs. You take a few thousands balls and connect most of them with springs of different strengths. You then take this thing and throw it on the floor; it will assume a shape that is implicitly encoded in spring strengths, its environment, and the way you've assembled it. You can even make it change shape if you poke on it the right way. That's how biology works in a nutshell; it's a nightmare to design anything for systems like that. Again, you can't simplify and break down and encapsulate and abstract like you do in programming.
Re: Moderna mRNA sequence released to GitHub [pdf]
#316Earlier quoted context omitted.
Why haven’t viruses or bacteria evolved to use a lipid nano particle to evade the immune system? Seems like a big security flaw in our cells?
I remember someone coming up with a song to encourage people to wash their hands more thoroughly much earlier in this pandemic. https://twitter.com/vesselofspirit/status/123748864242514739... According to the song lyric, "novel coronavirus / has a lipid outer shell". So it seems like some viruses have taken advantage of this.
Re: Moderna mRNA sequence released to GitHub [pdf]
#317Earlier quoted context omitted.
A pairwise sequence alignment done with `needle` starts like this: BioNTech_Pfiz 1 -----------GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAG 39 |||||.|.|..|||| ||| || Moderna 1 GGGAAATAAGAGAGAAAAGAAGAGTA----------------AGA---AG 31 BioNTech_Pfiz 40 AGAGA----AC-------CCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 78 |.|.| || |||||||||||||||||||||||||||||||| Moderna 32 AAATATAAGACCCCGGCGCCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 81 BioNTech_Pfiz 79 C…
Knowing nothing about biotech – if Moderna and Pfizer were working from the same sequencing data, why would their resulting vaccine mRNA sequences be different? Even slightly? Edit: I guess what I'm asking is: presumably these vaccines both target the spike protein. Do both of these sequences express the same protein? Or is there a "close enough!" thing in the immune system, where it can be a little different and sti…
Re: Moderna mRNA sequence released to GitHub [pdf]
#318Earlier quoted context omitted.
It's an interesting structure, but probably partly out of patent law. To wit, SARS-nCoV-2 is non-patentable, being of natural occurance. But a specific composition that encodes its spike protein, encapsulated in a lipid nanoparticle? That's much more of a creative work.
If it's just the spike protein encapsulated in a lipid nanoparticule (for isolation and transportation?), that looks like something not creative and quite established for people in the field of genetic material transport.
So somewhat like how a fishing fly differs from the insect it represents.
Re: Moderna mRNA sequence released to GitHub [pdf]
#319Earlier quoted context omitted.
" but vaccines do not bring in the bacon." As in, "do not generate enough income"? Really? Now?
Yes, really. Typical vaccines are like $5 to $200 or so. And worst of all, usually just one or two doses. For all the horror HIV has wrought, global spending on vaccine development for HIV has been around $1 billion a year for the last few years. In contrast, the USA federal government spends $3 billion a year for HIV antiviral drugs for low-income Americans. $20,000 per patient per year for life. Unsurprisingly, new…
Talk about market failures! It's completely obvious that this economical system is not placing the good of the whole human species as its first priority.
Re: Moderna mRNA sequence released to GitHub [pdf]
#320Earlier quoted context omitted.
Wait, you mean you don't extract genomic data from Excel? The MARCH1 gene brings many interesting surprises.
Excel finally has a facility for manipulating data that keeps it where you put it. It also incorporates a fairly decent functional programming language. It's called Power Query, not to be confused with all the other things that MS has named starting with "Power" and have no relationship at all and are mostly awful. The only real annoyance I have with it is that the editor window is modal, like it blocks all the sprea…