Hacker News Board Hacker News, browsed like a classic message board
Live data from Hacker News

Moderna mRNA sequence released to GitHub [pdf]

github.com

Post reply on HN
Print view View original

91–100 of 389 posts

Re: Moderna mRNA sequence released to GitHub [pdf]

#91

Post by koeng »

joeyh wrote: post #85

My first thought was `wdiff pdizer moderna`. It's short enough to post here in its entirity, but I guess I had better not, anyway it's easy enough to extract from the pdf. Add a space after every letter and wdiff can find the common sequences nicely. Short except for flavor, this is from near the beginning: A[-G-]AGA{+A+}GAA{+ATATAAGAC+}CCCG{+GCGCCG+}CCACCATGTTCGTGTTCCTGGTGCTGCTGCC[-T-]{+C+}

Us folks in biotech have a special tool just for this :) https://blast.ncbi.nlm.nih.gov/Blast.cgi

Unfortunately, the core algorithm dates back to 1990, so it can be real slow in some cases. Biotech takes a while to improve :(

Re: Moderna mRNA sequence released to GitHub [pdf]

#92

Post by Laforet »

sp1rit wrote: post #51

If my little knowledge from biology class serves me correct, RNA uses Udenine instead of Thymine. But in this document it uses T. Can somebody explain to me why?

The convention of genomic research is to present all RNA sequences as equivalent cDNA sequences. As this will be the output of most common sequencing platforms.

https://bioinformatics.stackexchange.com/questions/11353/why...

Re: Moderna mRNA sequence released to GitHub [pdf]

#93

Post by flobosg »

koeng wrote: post #91
joeyh wrote: post #85

My first thought was `wdiff pdizer moderna`. It's short enough to post here in its entirity, but I guess I had better not, anyway it's easy enough to extract from the pdf. Add a space after every letter and wdiff can find the common sequences nicely. Short except for flavor, this is from near the beginning: A[-G-]AGA{+A+}GAA{+ATATAAGAC+}CCCG{+GCGCCG+}CCACCATGTTCGTGTTCCTGGTGCTGCTGCC[-T-]{+C+}

Us folks in biotech have a special tool just for this :) https://blast.ncbi.nlm.nih.gov/Blast.cgi Unfortunately, the core algorithm dates back to 1990, so it can be real slow in some cases. Biotech takes a while to improve :(

I think you meant https://www.ebi.ac.uk/Tools/psa/emboss_needle/ or https://www.ebi.ac.uk/Tools/psa/emboss_water/ ;-)

Re: Moderna mRNA sequence released to GitHub [pdf]

#95

Post by azernik »

ur-whale wrote: post #57

What this does, as a non-biotech person, I believe I understand at a high level: plonk this code into a ribosome and out comes the desired protein. What I don't understand is: a) how the m-RNA code relates to the produced protein (i.e I can read C-code and get an idea of what is does fairly quickly, but can the same be said of m-RNA and the resulting protein)? b) how did they get their hands on that code in the first…

a) I don't know if protein-folding software is good enough to figure out the exact structure of the resulting protein given just the gene, but I suspect you could figure out through the equivalent of the strings command - looking for sub-chains of the protein, and looking for matching sequences in the gene

b) Coronaviruses happen to be RNA viruses; that is, their genomes are RNA rather than DNA. DNA viruses also exist and are common. We got full genomes from sequencing early in the pandemic, and continue to use it to monitor the evolution of the virus (see e.g. [1], where the results are available for download). Sequencing is very cheap and easy these days - you take a sample from a patient, use chemicals to break down all the cell membranes and such, sequence all of the DNA and RNA in it, and look through the results for a virus genome (i.e. something that isn't a human chromosome and isn't a known virus or bacterial genome). "m"RNA is more a description of the function than the chemical - tRNA and rRNA are short snippets of RNA used for manufacturing purposes inside the cell, while mRNA is the long chunks that actually carry information from the DNA to the protein manufacturing sites. Virus RNA basically functions as imposter mRNA, getting those manufacturing systems to make more viruses.

[1] https://www.ncbi.nlm.nih.gov/datasets/coronavirus/genomes/ - SARS-CoV-2 is the COVID-19 virus. As of my fetch, there are 71,509 full sequences of the virus, reflecting slight mutations over time and space.

Re: Moderna mRNA sequence released to GitHub [pdf]

#96

Post by callesgg »

anyfoo wrote: post #35
vmception wrote: post #4

Earlier quoted context omitted.

We aren’t that different from machines, we just need to know more about the CPU and all the co-processors and how the logic gates interact But for now we can inject code to trigger protein configuration via the immune system

> We aren’t that different from machines, we just need to know more about the CPU and all the co-processors and how the logic gates interact Except it is unfortunately not that simple, because it assumes that distinct components such as CPU, co-processors and even logic gates exist in that context, as is totally reasonable to assume on devices created by humans. Abstracting complex machines into distinct components i…

It is actually sort of strange how compartmentalized the living cell is.

I guess there is some type of redundancy that comes from compartmentalization that is evolutionarily beneficial.

Re: Moderna mRNA sequence released to GitHub [pdf]

#97

Post by flobosg »

joeyh wrote: post #85

My first thought was `wdiff pdizer moderna`. It's short enough to post here in its entirity, but I guess I had better not, anyway it's easy enough to extract from the pdf. Add a space after every letter and wdiff can find the common sequences nicely. Short except for flavor, this is from near the beginning: A[-G-]AGA{+A+}GAA{+ATATAAGAC+}CCCG{+GCGCCG+}CCACCATGTTCGTGTTCCTGGTGCTGCTGCC[-T-]{+C+}

A pairwise sequence alignment done with `needle` starts like this:

  BioNTech_Pfiz      1 -----------GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAG     39
                                  |||||.|.|..||||                |||   ||
  Moderna            1 GGGAAATAAGAGAGAAAAGAAGAGTA----------------AGA---AG     31
  
  BioNTech_Pfiz     40 AGAGA----AC-------CCGCCACCATGTTCGTGTTCCTGGTGCTGCTG     78
                       |.|.|    ||       ||||||||||||||||||||||||||||||||
  Moderna           32 AAATATAAGACCCCGGCGCCGCCACCATGTTCGTGTTCCTGGTGCTGCTG     81
  
  BioNTech_Pfiz     79 CCTCTGGTGTCCAGCCAGTGTGTGAACCTGACCACCAGAACACAGCTGCC    128
                       ||.||||||..|||||||||.|||||||||||||||.|.||.||||||||
  Moderna           82 CCCCTGGTGAGCAGCCAGTGCGTGAACCTGACCACCCGGACCCAGCTGCC    131

Re: Moderna mRNA sequence released to GitHub [pdf]

#98

Post by seiferteric »

maxerickson wrote: post #69
seiferteric wrote: post #54

Earlier quoted context omitted.

Umm, isn't that kind of scary? Like could you create a virus with this Ψ that our immune system can't fight at all?

It's part of an instruction to cells to make something. Viruses replicate by instructing cells to make viruses. Our cells don't know how to make Ψ, so the replicated virus would have the normal instruction.

Thanks, that is reassuring and makes sense. *at least until we figure out how to put the instructions to make it in the virus code :)

Re: Moderna mRNA sequence released to GitHub [pdf]

#99

Post by jeroenhd »

seiferteric wrote: post #54
tablespoon wrote: post #52

Earlier quoted context omitted.

> This is somewhat of a problem for our vaccine - it needs to sneak past our immune system. Over many years of experimentation, it was found that if the U in RNA is replaced by a slightly modified molecule, our immune system loses interest. For real. > So in the BioNTech/Pfizer vaccine, every U has been replaced by 1-methyl-3’-pseudouridylyl, denoted by Ψ. The really clever bit is that although this replacement Ψ pla…

Umm, isn't that kind of scary? Like could you create a virus with this Ψ that our immune system can't fight at all?

As denoted in the linked article [1]:

"Many people have asked, could viruses also use the Ψ technique to beat our immune systems? In short, this is extremely unlikely. Life simply does not have the machinery to build 1-methyl-3’-pseudouridylyl nucleotides. Viruses rely on the machinery of life to reproduce themselves, and this facility is simply not there. The mRNA vaccines quickly degrade in the human body, and there is no possibility of the Ψ-modified RNA replicating with the Ψ still in there. “No, Really, mRNA Vaccines Are Not Going To Affect Your DNA[2]“ is also a good read."

As far as I could tell, this would work well for getting a synthetic virus into the human body, but without the necessary mechanics within our cell, the special Ψ chemical won't be reproduced by the virus. That'd mean the replicated virus would get snatched up by the immune system as soon as it'd get released from the cell.

Theoretically, a complex enough RNA string could be used to have our cells build the necessary cellular machinery to properly reproduce the virus, but that's a kind of altering DNA that's a whole different can of worms. There's probably cheaper and easier way of defeating the immune system, for example by simply "enhancing" ebola or HIV to make them more infectious and more resistant to our current drugs.

[1]: https://berthub.eu/articles/posts/reverse-engineering-source... [2]: https://www.deplatformdisease.com/blog/no-really-mrna-vaccin...

Re: Moderna mRNA sequence released to GitHub [pdf]

#100

Post by wespiser_2018 »

azernik wrote: post #70
drtz wrote: post #31

I'm sure it's more complex than I grasp as a layperson, but I'm utterly amazed at how simple this _appears_. I get the feeling that this is something I have a better chance of understanding than the average SaaS Terms and Conditions. I expected to have to scroll through pages upon pages of indecipherable text. Instead it's no bigger than a large paragraph of text, and I can easily fit it on my screen.

The protein they're trying to manufacture is indeed quite simple - AFAIU both BioNTech and Moderna put together their sequences in a weekend. (Though there was a more involved process of winnowing down the sequences for the most effective ones.) The technically challenging parts are: - delivery mechanism: you need to take a very unstable molecule, protect it from the environment - both external, and when inside the p…

from what I've gathered, the rate limiting step for production as of yet, is creating the lipid vesicles and getting the RNA inside of them. Only a few companies have a process for this, and the supply chain for the precursors is limited as well.
Post reply on HN