Hacker News Board Hacker News, browsed like a classic message board
Live data from Hacker News

Moderna mRNA sequence released to GitHub [pdf]

github.com

Post reply on HN
Print view View original

81–90 of 389 posts

Re: Moderna mRNA sequence released to GitHub [pdf]

#81

Post by schoen »

azernik wrote: post #70
drtz wrote: post #31

I'm sure it's more complex than I grasp as a layperson, but I'm utterly amazed at how simple this _appears_. I get the feeling that this is something I have a better chance of understanding than the average SaaS Terms and Conditions. I expected to have to scroll through pages upon pages of indecipherable text. Instead it's no bigger than a large paragraph of text, and I can easily fit it on my screen.

The protein they're trying to manufacture is indeed quite simple - AFAIU both BioNTech and Moderna put together their sequences in a weekend. (Though there was a more involved process of winnowing down the sequences for the most effective ones.) The technically challenging parts are: - delivery mechanism: you need to take a very unstable molecule, protect it from the environment - both external, and when inside the p…

> Hence they feel safe releasing this. Their moat is not the gene sequence, their moat is everything else.

One or more of the vaccine developers may have released such details, but this particular file is a reverse engineering effort by unaffiliated scientists based on analyzing the dregs of used vaccine vials (!).

Edit: See https://news.ycombinator.com/item?id=26628594 for more substantive discussion about this.

Re: Moderna mRNA sequence released to GitHub [pdf]

#82

Post by ur-whale »

koeng wrote: post #75
ur-whale wrote: post #57

What this does, as a non-biotech person, I believe I understand at a high level: plonk this code into a ribosome and out comes the desired protein. What I don't understand is: a) how the m-RNA code relates to the produced protein (i.e I can read C-code and get an idea of what is does fairly quickly, but can the same be said of m-RNA and the resulting protein)? b) how did they get their hands on that code in the first…

Answers: a) From the mRNA you can learn the amino acid sequence of the protein very quickly. You absolutely cannot (yet) learn the function of the protein from that sequence - normally, people just do comparisons with proteins whose functions ARE known. Oftentimes in enzymes there are "domains" or little functional regions that stay consistent over long periods of time, so that's a good way to assign function (given…

Thanks !

Re: Moderna mRNA sequence released to GitHub [pdf]

#83

Post by airstrike »

drtz wrote: post #31

I'm sure it's more complex than I grasp as a layperson, but I'm utterly amazed at how simple this _appears_. I get the feeling that this is something I have a better chance of understanding than the average SaaS Terms and Conditions. I expected to have to scroll through pages upon pages of indecipherable text. Instead it's no bigger than a large paragraph of text, and I can easily fit it on my screen.

> and I can easily fit it on my screen.

...with GATACCA right in the middle, but unfortunately with no GATTACA that I could find.

Re: Moderna mRNA sequence released to GitHub [pdf]

#85

Post by joeyh »

My first thought was `wdiff pdizer moderna`. It's short enough to post here in its entirity, but I guess I had better not, anyway it's easy enough to extract from the pdf. Add a space after every letter and wdiff can find the common sequences nicely.

Short except for flavor, this is from near the beginning:

A[-G-]AGA{+A+}GAA{+ATATAAGAC+}CCCG{+GCGCCG+}CCACCATGTTCGTGTTCCTGGTGCTGCTGCC[-T-]{+C+}

Re: Moderna mRNA sequence released to GitHub [pdf]

#88

Post by julienchastang »

koeng wrote: post #36

The thinking behind attaching a PDF with colors and not a Genbank file is why we can't have nice things in biotechnology.

Exactly. FAIR (Findable, Accessible, Interoperable and Reusable) principles are at a loss here [1]. The "Reusable" part seems to be especially problematic as the sequence is buried in a PDF file though all aspects of FAIR are compromised here. Edit: It looks like there is now a PR to address this issue [2]

[1] https://www.nature.com/articles/sdata201618

[2] https://github.com/NAalytics/Assemblies-of-putative-SARS-CoV...

Re: Moderna mRNA sequence released to GitHub [pdf]

#89

Post by snuxoll »

airhead969 wrote: post #67
andrewcl wrote: post #42

Cool, but it's the lipid delivery system that is the secret sauce. This is equivalent to giving the source code without a compiler to build it.

Wouldn't the "compiler" be the bioreactor used to mass-produce it and the "installer" be the lipid encapsulation? :)

InstallGene by Flexera

Re: Moderna mRNA sequence released to GitHub [pdf]

#90

Post by WheelsAtLarge »

hfjfktmtkrn wrote: post #47
drtz wrote: post #31

I'm sure it's more complex than I grasp as a layperson, but I'm utterly amazed at how simple this _appears_. I get the feeling that this is something I have a better chance of understanding than the average SaaS Terms and Conditions. I expected to have to scroll through pages upon pages of indecipherable text. Instead it's no bigger than a large paragraph of text, and I can easily fit it on my screen.

It's not really that simple. Only two companies in the world succeeded, the French company Sanofi which also tried making a mRNA vaccine failed.

True, most pharmaceuticals can't do it now but given the right knowledge, which is known, it can be done relatively fast. I suspect in the next few years there will be many companies that will be able to replicate and advance the process.
Post reply on HN