Live data from Hacker News

Baby is healed with first personalized gene-editing treatment

nytimes.com

61–70 of 570 posts

Re: Baby is healed with first personalized gene-editing treatment

#61

Good thing RFK pushed out the official overseeing this financing and the current administration is actively defunding the organizations that produced this. Better to have more disabled or dead babies instead of science. /s

From a purely utilitarian perspective, funding research like this is not an effective use of dollars at the margin. How many people could we save if an equivalent amount was put into reducing obesity, smoking, and drinking? How many people could we save if we stopped spending money we don't have to do things that the government isn't competent at allocating anyways? That's not to say the research itself is not impres…

a) that statement above has nothing to do with RFK

b) the whole point of NIH and other government research funds is to pay for this sort of "not clearly an effective use of dollars" type of research that Pfizer et al won't touch. but you can look at a ton of future applications from this - lipid packaging, CRISPR methods, drug delivery, etc that had to be devised, and could conceivably be commercially viable if the methodology is perfected and the cost comes down.

Re: Baby is healed with first personalized gene-editing treatment

#64
post #31

> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene. They also carry a molecular GPS — CRISPR — which was altered to crawl along a person’s DNA until it finds the exact DNA letter that needs to be c…

Made it sound like it's a computer, is it Turing complete?

Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.

Re: Baby is healed with first personalized gene-editing treatment

#65
post #31

> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene. They also carry a molecular GPS — CRISPR — which was altered to crawl along a person’s DNA until it finds the exact DNA letter that needs to be c…

Made it sound like it's a computer, is it Turing complete?

It's fundamentally different than a computer and arguably more complete.

The talk of "crawling along the genome" is kinda fundamentally wrong though and is a bit irking - CRISPR kinda just bumps around until it hits a PAM site, in which case it starts checking against sgRNA. Much more random than they make it seem

Re: Baby is healed with first personalized gene-editing treatment

#66
post #22

Earlier quoted context omitted.

From a purely utilitarian perspective, funding research like this is not an effective use of dollars at the margin. How many people could we save if an equivalent amount was put into reducing obesity, smoking, and drinking? How many people could we save if we stopped spending money we don't have to do things that the government isn't competent at allocating anyways? That's not to say the research itself is not impres…

I’m glad we don’t only think from a utilitarian perspective then.

It's not even that. Utilitarian premises still let a very broad set of perspective. A long term perspective on large humanity won't lead to same conclusion as what will be the most joy inducing experiences in the next 24h for the 1% wealthiest people in the world right now.

Re: Baby is healed with first personalized gene-editing treatment

#67
post #31

> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene. They also carry a molecular GPS — CRISPR — which was altered to crawl along a person’s DNA until it finds the exact DNA letter that needs to be c…

Made it sound like it's a computer, is it Turing complete?

Yeah, in some ways, the genetic code and molecular biology around transcription, etc, more closely resembles the abstract Turing Machine than an actual computer does. Absolutely fascinating that the messy world of biology ends up being pretty analogous to the clean world of binary logic. Gene sizes are expressed in kilobases, where a base carries 2 bits of information.

Re: Baby is healed with first personalized gene-editing treatment

#68

Research funded by the NIH which our government is actively gutting

Yep, this effort is the culmination of 50 years of research. Could be the last harrah of the NIH with the amount of cuts we've had and the scientists who are taking jobs in other countries.

Re: Baby is healed with first personalized gene-editing treatment

#69

Earlier quoted context omitted.

I think you may be operating under the assumption that the extremely expensive price tag will need to be repeated for each patient. In reality, as this process becomes more mature it is going to become inexpensive. The reduction in cost will almost certainly be similar to reduction in cost needed to sequence an individual's genome, which has fallen from tens of millions to hundreds of dollars. The only catch is that…

> In reality, as this process becomes more mature it is going to become inexpensive. There's no evidence to support that gene therapy will ever be inexpensive. We can merely say that the process may become less shockingly expensive.

What should we as humanity, as society, spend most of our wealth and resources doing?

Sending robber barrons and their girlfriends into space?

Re: Baby is healed with first personalized gene-editing treatment

#70

NYT isn’t super specific here, but they made it sound like the disease treated is liver related. My understanding is that the liver is a good place to start with CRISPR-type gene treatments, in that the liver normally deals with anomalous shit in your bloodstream, say, like CRISPR type edits. So anywhere outside the liver is going to be significantly harder to get really broad uptake of gene edits. It’s crazy encoura…

It is caused by a missing enzyme in the liver, yes.
Post reply on HN