Live data from Hacker News

Moderna mRNA sequence released to GitHub [pdf]

github.com

361–370 of 389 posts

Re: Moderna mRNA sequence released to GitHub [pdf]

#361
post #31

I'm sure it's more complex than I grasp as a layperson, but I'm utterly amazed at how simple this _appears_. I get the feeling that this is something I have a better chance of understanding than the average SaaS Terms and Conditions. I expected to have to scroll through pages upon pages of indecipherable text. Instead it's no bigger than a large paragraph of text, and I can easily fit it on my screen.

People tend to think of genetic code as a sort of assembly language which is very verbose, but I wonder if the correct way to view it is in fact a very terse domain-specific language, because it actually depends on the entire complex machinery of the cell to be present in order to work, which in itself contains a lot of information?

> I wonder if the correct way to view it is in fact a very terse domain-specific language

Honestly, na. It's pretty verbose. There's a lot of weird ass things in there like "Skip basepairs until you find the matching terminating sequence" (I think it's AG .* GA but its been a decade since my bioinformatics course), but you still have to include the non-AA-coding basepairs in the middle of that.

Compensating for that is the fact that there are like, multiple independent programs; if a ribosome is offset by a single base pair, the result is entirely different. If it runs the other strand, the result is different. And instead of crashing like any program would, biology just learns to use all of those possible encodings. In part, this works because there are 64 possible codons but only 20 amino acids, and the redundancy allows a substitution to affect only some of the offsets.

Re: Moderna mRNA sequence released to GitHub [pdf]

#362

Earlier quoted context omitted.

Which makes me wonder. Could you place the entire virus genome in these liposomes and get them to hijack the machinery to make an entire virus? Like plasmid but for viral structures?

Yes, that's one of the concerns many have about this technology. Literally, anything can be injected and done at this point. Not sure where the technology is exactly at, but I suspect we're no more than 5 years from major incident related to this. Even this vaccine, we really don't know the long-term impacts or risks involved with this. For instance, this vaccine does appear more risky than the standard flu vaccine:…

Do you happen to have a more verifiable source for your claim that COVID-19 vaccines are more risky than the flu vaccine?

Excerpt from the disclaimer in your source:

> VAERS accepts reports of adverse events and reactions that occur following vaccination. Healthcare providers, vaccine manufacturers, and the public can submit reports to VAERS. While very important in monitoring vaccine safety, VAERS reports alone cannot be used to determine if a vaccine caused or contributed to an adverse event or illness. The reports may contain information that is incomplete, inaccurate, coincidental, or unverifiable. Most reports to VAERS are voluntary, which means they are subject to biases. This creates specific limitations on how the data can be used scientifically. Data from VAERS reports should always be interpreted with these limitations in mind.

Re: Moderna mRNA sequence released to GitHub [pdf]

#364

Cool, but it's the lipid delivery system that is the secret sauce. This is equivalent to giving the source code without a compiler to build it.

Wouldn't the "compiler" be the bioreactor used to mass-produce it and the "installer" be the lipid encapsulation? :)

In the case the bioreactor “compiler” is actually our own cells which read out the mRNA “source code” and translate it into protein. The lipid encapsulation delivers the mRNA to our cells, so perhaps it’s more analogous to a network protocol that delivers source code intact across firewalls and other defenses.

Re: Moderna mRNA sequence released to GitHub [pdf]

#365
post #97

Earlier quoted context omitted.

A pairwise sequence alignment done with `needle` starts like this: BioNTech_Pfiz 1 -----------GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAG 39 |||||.|.|..|||| ||| || Moderna 1 GGGAAATAAGAGAGAAAAGAAGAGTA----------------AGA---AG 31 BioNTech_Pfiz 40 AGAGA----AC-------CCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 78 |.|.| || |||||||||||||||||||||||||||||||| Moderna 32 AAATATAAGACCCCGGCGCCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 81 BioNTech_Pfiz 79 C…

Knowing nothing about biotech – if Moderna and Pfizer were working from the same sequencing data, why would their resulting vaccine mRNA sequences be different? Even slightly? Edit: I guess what I'm asking is: presumably these vaccines both target the spike protein. Do both of these sequences express the same protein? Or is there a "close enough!" thing in the immune system, where it can be a little different and sti…

> if Moderna and Pfizer were working from the same sequencing data, why would their resulting vaccine mRNA sequences be different? Even slightly?

Ever tried to compile the same source with different compilers?

Re: Moderna mRNA sequence released to GitHub [pdf]

#366
post #202

Earlier quoted context omitted.

> I have a "I'm sure that means something to somebody" feeling. Break it down! It's not so bad: > A composition A bunch of stuff > a messenger ribonucleic acid (mRNA) mRNA are cellular instructions on how to make proteins that are read by ribosomes that make those proteins as they read along. > an open reading frame This is something that starts with a "start codon" and ends with an "ending codon" and encodes valid i…

Doesn't this describe almost ANY vaccine - I think that it's probably bad public policy to allow anyone to patent ALL COVID vaccines - I think that patenting a particular vaccine (a particular mRNA string) should be allowed, but not effective wildcards in the RNA

No. It doesn't describe the viral vector vaccines (J&J/AstraZeneca). It doesn't describe the inactivated virus vaccines. It doesn't include the viral fragment (NovaVax) vaccines. And it wouldn't describe some possible mRNA vaccines because of differences in formulation or differences in targeting.

While this particular Moderna claim would likely affect BioNTech/Pfizer's mRNA vaccine, it's not clear whether it would survive in litigation, too.

As to a "specific string"-- if you could just pad a few codons onto the end and not be violating the patent, that's not too worthwhile.

Re: Moderna mRNA sequence released to GitHub [pdf]

#367
I highly recommend reading about Ribosomes. They are made up of two pieces that were likely independent at some time. It becomes quite clear that "life" began as a machine that all it could do was replicate itself:

https://en.wikipedia.org/wiki/Ribosome

You can think of RNA as a copy of a section of DNA. They look very much like computer programs except rather than producing code, the Ribosome can read them and translate each codon for an amino acid into its corresponding actual amino acid that it then binds together into a protein. The execution engine is the environment of the cell. All highly probabilistic rather than deterministic. I can't imagine any programmer not finding them completely fascinating.

Re: Moderna mRNA sequence released to GitHub [pdf]

#370
post #349

Earlier quoted context omitted.

Not 10k year as it needs to go through the million years scale - rna, hot, uv then dna ... with no oxygen to oxygen etc. Then million of years of evolving ... scale is a bit off.

He's saying if you wiped out human civilization it would take O(10k) years to rebuild, because knowledge/culture isn't stored in the genes.

Yep exactly, but also that's a fun problem to think about how long it would take if we sent our DNA on an asteroid/space probe to another earth-like planet. :)
Post reply on HN