Hacker News Board Hacker News, browsed like a classic message board
Live data from Hacker News

Moderna mRNA sequence released to GitHub [pdf]

github.com

Post reply on HN
Print view View original

351–360 of 389 posts

Re: Moderna mRNA sequence released to GitHub [pdf]

#351

Post by jcims »

shpongled wrote: post #246
nielsbot wrote: post #236

Earlier quoted context omitted.

It blows my mind to see how life (and death) work at the molecular level--it's almost like some kind of manmade machine, but far more subtle and complex.

As a biochemist, that's one of the things that has kept me interested in the work - it's truly mind boggling what is going on at the molecular level every second of our lives.

I love reading articles around biology, micro/molecular biology in particular, and looking for references to agency in the text. 'selects', 'filters', 'checks', 'seeks', etc when the reality is that the whole thing is just a massive chemical reaction.

Re: Moderna mRNA sequence released to GitHub [pdf]

#352

Post by asdff »

koeng wrote: post #91
joeyh wrote: post #85

My first thought was `wdiff pdizer moderna`. It's short enough to post here in its entirity, but I guess I had better not, anyway it's easy enough to extract from the pdf. Add a space after every letter and wdiff can find the common sequences nicely. Short except for flavor, this is from near the beginning: A[-G-]AGA{+A+}GAA{+ATATAAGAC+}CCCG{+GCGCCG+}CCACCATGTTCGTGTTCCTGGTGCTGCTGCC[-T-]{+C+}

Us folks in biotech have a special tool just for this :) https://blast.ncbi.nlm.nih.gov/Blast.cgi Unfortunately, the core algorithm dates back to 1990, so it can be real slow in some cases. Biotech takes a while to improve :(

You can also run blast locally if you need to throw more hardware at it.

Re: Moderna mRNA sequence released to GitHub [pdf]

#353

Post by failwhaleshark »

adgjlsfhk1 wrote: post #240
failwhaleshark wrote: post #199

Earlier quoted context omitted.

There are roughly 75 million HCV infections in the world. That translates to a total cure cost of: 75M * $350k = $26.25T There are other ARV treatments available which cost now roughly $50-100k and cure in 3 months. Whereas immunizing everyone against coronaviruses currently costs: 8B * $7 = $56B Clearly, the costs of the HCV cure are predatory and unreasonable because it doesn't lead to eradication and it's inaccess…

It's also worth noting that if it's $7 for the payer, there's a lot less than $7 of profit.

The true unit cost is probably $6 per dose. The COVID vaccines may break-even short-term. Long-term, it's probably worth keeping an extra 120M potential customers alive for what will probably result in a small profit.

The true unit cost of HCV cures is unknowable but possibly half of the current price.

Re: Moderna mRNA sequence released to GitHub [pdf]

#354

Post by asdff »

csense wrote: post #263

The Human Genome Project was completed almost two decades ago, and somebody solved the protein folding problem recently. Why are we still doing genetics at the machine code level? Shouldn't we have some compilers, assemblers and linkers by now?

Because it's a harder problem than it seems at face value.

Re: Moderna mRNA sequence released to GitHub [pdf]

#355

Post by fiftyfifty »

drtz wrote: post #31

I'm sure it's more complex than I grasp as a layperson, but I'm utterly amazed at how simple this _appears_. I get the feeling that this is something I have a better chance of understanding than the average SaaS Terms and Conditions. I expected to have to scroll through pages upon pages of indecipherable text. Instead it's no bigger than a large paragraph of text, and I can easily fit it on my screen.

The New York Times published an article last year with the entire genome of the SARS-Cov-2 virus, with a breakdown of different sections to explain what protein the RNA codes for and what that protein does. Like you said it was amazing that it all fit within an [albeit long] newspaper article. It doesn't surprise me that the RNA for the vaccine, which only targets a single protein, is even smaller than that. Here's the NY Times article I was referring too:

https://www.nytimes.com/interactive/2020/04/03/science/coron...

Re: Moderna mRNA sequence released to GitHub [pdf]

#356

Post by dnautics »

nielsbot wrote: post #236
jcims wrote: post #231

Earlier quoted context omitted.

This is a great animation of the life cycle of an HIV virus. It’s not exactly what happens with the pandemic virus but it gives you a good idea of the complexity of the process of viral reproduction (vaccine or immune response isn’t covered here): https://vimeo.com/260291607 Animation of transcription from mRNA: https://youtu.be/TfYf_rPWUdY

It blows my mind to see how life (and death) work at the molecular level--it's almost like some kind of manmade machine, but far more subtle and complex.

Just remember that it's not really orchestrated. All of the molecules involve are kind of randomly blundering about and it's one-in-a-million collisions that are responsible for getting shit done (on membranes it's more like one in a thousand and on ropelike structures like dna or actin it's one in a hundred).

Re: Moderna mRNA sequence released to GitHub [pdf]

#357

Post by gremlinsinc »

drtz wrote: post #31

I'm sure it's more complex than I grasp as a layperson, but I'm utterly amazed at how simple this _appears_. I get the feeling that this is something I have a better chance of understanding than the average SaaS Terms and Conditions. I expected to have to scroll through pages upon pages of indecipherable text. Instead it's no bigger than a large paragraph of text, and I can easily fit it on my screen.

The way it reads like source code, truly makes me circle back to the idea we're all living in a simulation.

Re: Moderna mRNA sequence released to GitHub [pdf]

#358

Post by wonderwonder »

hutzlibu wrote: post #153
wonderwonder wrote: post #28

We are simply programmable machines, its pretty interesting that all of human life can be reduced down to 30k editable microservices.

"its pretty interesting that all of human life can be reduced down to 30k editable microservices." I don't know much about DNA and co, but it sounds as microservice is not the right metapher. Rather just 30k sourcecode? Because a microservice is something that is already compiled and running..

Was looking at it as each gene is a microservice and performs a role. Those microservices can be added to, edited / eliminated or swapped out.
Post reply on HN