Moderna mRNA sequence released to GitHub [pdf]

Post by sanxiyn » Tue, Mar 30, 2021, 1:52 AM UTC

type_enthusiast wrote: post #110

flobosg wrote: post #97

Earlier quoted context omitted.

A pairwise sequence alignment done with `needle` starts like this: BioNTech_Pfiz 1 -----------GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAG 39 |||||.|.|..|||| ||| || Moderna 1 GGGAAATAAGAGAGAAAAGAAGAGTA----------------AGA---AG 31 BioNTech_Pfiz 40 AGAGA----AC-------CCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 78 |.|.| || |||||||||||||||||||||||||||||||| Moderna 32 AAATATAAGACCCCGGCGCCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 81 BioNTech_Pfiz 79 C…

Knowing nothing about biotech – if Moderna and Pfizer were working from the same sequencing data, why would their resulting vaccine mRNA sequences be different? Even slightly? Edit: I guess what I'm asking is: presumably these vaccines both target the spike protein. Do both of these sequences express the same protein? Or is there a "close enough!" thing in the immune system, where it can be a little different and sti…

Post by hutzlibu » Tue, Mar 30, 2021, 1:58 AM UTC

mikecoles wrote: post #192

hutzlibu wrote: post #165

Earlier quoted context omitted.

"Hepatitis C treatments" We don't really need the same quantities of that, though.

https://www.hhs.gov/hepatitis/learn-about-viral-hepatitis/da... It can be said that hepatitis care is more necessary than covid.

Post by ethbr0 » Tue, Mar 30, 2021, 1:59 AM UTC

mikehollinger wrote: post #167

dnautics wrote: post #125

Earlier quoted context omitted.

sequence is actually released by Moderna in their patent: https://www.modernatx.com/sites/default/files/US10702600.pdf though they do present multiple sequences, so I guess you'd have to go to the FDA application to figure out exactly which one got used.

Reading the primary claim is fascinating: "A composition, comprising: a messenger ribonucleic acid (mRNA) comprising an open reading frame encoding a betacoronavirus (BetaCoV) S protein or S protein subunit formulated in a lipid nanoparticle." I have a "I'm sure that means something to somebody" feeling. It's also surprising that the remaining claims seem to describe the resulting bits of the sequence, and that that…

Post by The_rationalist » Tue, Mar 30, 2021, 2:04 AM UTC

azernik wrote: post #70

drtz wrote: post #31

I'm sure it's more complex than I grasp as a layperson, but I'm utterly amazed at how simple this _appears_. I get the feeling that this is something I have a better chance of understanding than the average SaaS Terms and Conditions. I expected to have to scroll through pages upon pages of indecipherable text. Instead it's no bigger than a large paragraph of text, and I can easily fit it on my screen.

The protein they're trying to manufacture is indeed quite simple - AFAIU both BioNTech and Moderna put together their sequences in a weekend. (Though there was a more involved process of winnowing down the sequences for the most effective ones.) The technically challenging parts are: - delivery mechanism: you need to take a very unstable molecule, protect it from the environment - both external, and when inside the p…

Post by failwhaleshark » Tue, Mar 30, 2021, 2:14 AM UTC

hadlock wrote: post #154

hutzlibu wrote: post #138

Earlier quoted context omitted.

" but vaccines do not bring in the bacon." As in, "do not generate enough income"? Really? Now?

Current pricing for mRNA vaccines is something in the $4-7 dollars (that's $7.00 dollars, not $7,000.00 dollars) range. Compare that to one of the Hepatitis C treatments, which costs north of $350,000 by several accounts. Even remdesivir is something like $3000 for a course.