181–190 of 570 posts
Earlier quoted context omitted.
Made it sound like it's a computer, is it Turing complete?
Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.
Earlier quoted context omitted.
One other fun part of gene editing in vivo is that we don't actually use GACU (T in DNA). It turns out that if you use Pseudouridine (Ψ) instead of uridine (U) then the body's immune system doesn't nearly alarm as much, as it doesn't really see that mRNA as quite so dangerous. But , the RNA -> Protein equipment will just make protiens it without any problems. Which, yeah, that's a miraculous discovery. And it was wel…
> [...] then the body's immune system doesn't nearly alarm as much, as it doesn't really see that mRNA as quite so dangerous Please tell me there are measures to prevent this going into the wild. Please tell me this won't be used in large-scale industrial farming.
Earlier quoted context omitted.
I think part of the problem is that “really good” and “really bad” are not universally accepted norms for any given ethical question. What you’re seeing is your own value system assumptions being checked. It’s perfectly reasonable to say that while a technology has the propensity to be used for evil, it also has positive applications and that the real benefit now outweighs the potential downside in a hypothetical fut…
>This is one of those things that is easy to say precisely due to the impossibility of it ever actually becoming a real decision you have to make. It's true. But things like this should be easy to say right? Like we may not be able to act logically. But we should be able to think logically, communicate logically and show that we are aware of what is logical. My post got flagged meaning a lot of people can't separate…
It would maybe be easier for a 15-25 y.o. to kill a baby they don't know and whose parents/family they don't know, and maybe even easier if they don't speak their language or look like them. Of course, the baby wouldn't be the only one you'd have to kill, most likely.
I submit that it would be very very different if you found out that your 4 year old child was going to go on to be the next Hitler. For a "normal" person, I think they would go to the ends of the earth to try to shape them into the kind of person that wouldn't do it. I think very few people would coldly calculate "welp, guess I gotta execute this adorable little child I've grown so attached to" as it looks up at them saying "I love you so much forever, mommy/daddy" with their little doe eyes.
(ETA: it also brings up side questions about nature vs nurture and free will)
And then consider the lifelong repercussions of the emotional fallout. You can use all the logic in the world to justify the action, but your human brain will still torment you over it. And likely, most of the other human brains that learn about it would torment you as well.
---
So, while I think you can say things like that, ie the ability and allowance, I think you should question whether you should. I think saying those kinds of things really doesn't add much to the discussion because I believe it's really just an uninformed platitude that only someone with a lack of life experience would believe.
For me this all highlights the fact that meaty ethical questions don't have a simple reductive answer. Which ties back in to the original problem that OP outright states that this is simply and clearly the wrong path to go down.
(PS the downvoting/flagging could be due to breaking the guidelines around discussing downvotes and flags, and not actually due to the topical content of the posts, and/or assuming bad faith on the part of other users as such: https://news.ycombinator.com/newsguidelines.html)
> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene. They also carry a molecular GPS — CRISPR — which was altered to crawl along a person’s DNA until it finds the exact DNA letter that needs to be c…
> That is one of the most incredible things I have ever read. This is even more great reading behind the above: https://en.wikipedia.org/wiki/Jennifer_Doudna
Earlier quoted context omitted.
I suppose a downside (depending on your perspective) of this is that it will make people who are genetically modified in this fashion trivial to detect. That's good if your goals are to detect genetic modification which may be considered cheating in competitive sports. That's bad if your goals are to detect genetically modified people and discriminate against them. I see a near future where the kind of people who loa…
Careful with qualifiers there. I genuinely believe that vaccines can spread illness to the non-vaccinated, since it has happened many times and is well-documented. For example, it's why only the inactivated (aka "dead" virus) polio vaccine has been used in the US since 2000. I'm not arguing about whether the risks of the attenuated virus outweigh the benefits. I think the data are very clear there. (Heh -- and I'm su…
To me the wildest scenarios take this off the table.
Earlier quoted context omitted.
It's not a slippery slope. Fixing defects is rather straightforward, since it's usually a single gene that needs to be edited. If you want make your baby smarter, taller, or more handsome, it's not so easy because these traits involve 1000s of genes. For this reason I do not think that curying diseases will lead to designer babies.
If you can affect germline cells, then I don't see how it's not a slippery slope. (I'm not arguing against doing it, just that it is a slope and the slope is slippery.) No designer babies necessary. I'll steelman "fixing defects" by sticking to serious hereditary diseases (and yes, only those that correspond to one or a few known genes). As more and more conditions become treatable, the population with access to reso…
But, I think that it's misguided to apply the human problem of othering to a given technology. Regardless of technology X, humans are gonna human. So, if X helps some people, we should consider it on that basis. Because without X, we will still have an endless stream of other reasons to draw red lines, as you allude to. Except in addition we'll also still have the problem that X could've helped solve.
If gene editing to cure diseases leads to a future where people want to shunt off the poor that are now the outsized burden of the healthcare system, the answer from where I sit is to find ways to make the gene therapies available to them, not to cart them off to concentration camps while they await extermination. This will require all the trappings of human coordination we've always had.
Preventing X from ever coming to fruition doesn't at all prevent all possible futures where concentration death camps are a possibility. To me they are orthogonal concerns.
Even if you can convince one culture/society not to do it, how do you stop others? Force? Now you have a different manifestation of the same problem to solve. Society needs to learn how to "yes, and..." more when it comes to this stuff. Otherwise, it's just war all the way down.
Earlier quoted context omitted.
One other fun part of gene editing in vivo is that we don't actually use GACU (T in DNA). It turns out that if you use Pseudouridine (Ψ) instead of uridine (U) then the body's immune system doesn't nearly alarm as much, as it doesn't really see that mRNA as quite so dangerous. But , the RNA -> Protein equipment will just make protiens it without any problems. Which, yeah, that's a miraculous discovery. And it was wel…
I suppose a downside (depending on your perspective) of this is that it will make people who are genetically modified in this fashion trivial to detect. That's good if your goals are to detect genetic modification which may be considered cheating in competitive sports. That's bad if your goals are to detect genetically modified people and discriminate against them. I see a near future where the kind of people who loa…
Research funded by the NIH which our government is actively gutting
Earlier quoted context omitted.
Not under the current way we do things, I don't imagine. So the real trick here isn't the mRNA, it's the nanobubbles. Basically, you're putting these bits of mRNA into these little fat bubbles and then injecting those into the blood. Making those bubble shelf stable is really hard , hence the issues with temperature and the covid vaccine. To then make those little fat bubbles stable-ish in the blood is also a really…
I think it doesn't need to be a direct weapon to be used in warfare. You can genetically modify your own military.
Something that a lot of people are unaware of is that US Military is allowed to do this. I forget the exact EO, but it was signed by Clinton and is in the 12333 chain of EOs. Mostly, this is used for the Anthrax vaccine. But, it does give clearance to do other forms of medical experimentation on warfighters.
No, really, I am serious here. This is true. I may have the details a bit off, so sorry there, but they can and do preform medical experiments on people without their consent. Now, to be fair, France does this too. They do sham surgeries over there. Non-consenting human medical experimentation is quite the rabbit-hole.
So, I can kinda see in the next 10 years, certainly the next 50, a routine shot given to warfighters to help them with things like blood loss, or vitamin C production, or fast twitch muscles, or whatever. The legal framework is already there and has been for a while, it's just an efficacy issue, honestly.
> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene. They also carry a molecular GPS — CRISPR — which was altered to crawl along a person’s DNA until it finds the exact DNA letter that needs to be c…
> until it finds the exact DNA letter that needs to be changed.
This pine is disingenuous (at best). There is no way of guaranteeing where the DNA is inserted. It is designed to only slot into a very specific portion of the DNA but they don't have a way to control that precisely, the accuracy is high but "exact DNA letter" is skipping over a few pretty important details.
To be clear I'm not saying it is ineffective or unsafe, only that the claim made is marketing speak and not actually true.