My question is does the Johnson & Johnson DNA-based vaccine encode for the exact same spike protein, or a different one they chose to target? From this PDF I conclude both the moderna and Pfizer vaccines target the same protein.
Moderna mRNA sequence released to GitHub [pdf]
111–120 of 389 posts
Re: Moderna mRNA sequence released to GitHub [pdf]
#112Earlier quoted context omitted.
Here is a breakdown https://berthub.eu/articles/posts/reverse-engineering-source... discussed previously https://news.ycombinator.com/item?id=25538820
> This is somewhat of a problem for our vaccine - it needs to sneak past our immune system. Over many years of experimentation, it was found that if the U in RNA is replaced by a slightly modified molecule, our immune system loses interest. For real. > So in the BioNTech/Pfizer vaccine, every U has been replaced by 1-methyl-3’-pseudouridylyl, denoted by Ψ. The really clever bit is that although this replacement Ψ pla…
We are really quite fortunate that there was a ton of work done on coronaviruses, mRNA vaccines, adenovirus vaccines, etc prior to the pandemic. It seems like a pandemic even a year or three prior would have made the vaccine rollout considerably slower.
Re: Moderna mRNA sequence released to GitHub [pdf]
#113Earlier quoted context omitted.
The protein they're trying to manufacture is indeed quite simple - AFAIU both BioNTech and Moderna put together their sequences in a weekend. (Though there was a more involved process of winnowing down the sequences for the most effective ones.) The technically challenging parts are: - delivery mechanism: you need to take a very unstable molecule, protect it from the environment - both external, and when inside the p…
> delivery mechanism: you need to take a very unstable molecule, protect it from the environment - both external, and when inside the patient - and insert it into a human cell. (This is called the "platform", and is usually developed independently from the specific payload.) Of note, the immune system is pretty good at destroying foreign mRNA so you also need to evade it. This article is pretty good: https://berthub.…
I wouldn't even say the immune system, your body has a ton of nonspecific RNA-digesting enzymes floating around to patrol for exactly this sort of thing happening, even by accident, as cells can sometimes rupture. It's a problem enough that good RNA researchers have a reputation of being clean freaks. Some RNA labs I've been in had a lingering, slightly sweet smell, that's the nonspecific RNAase inhibitor that gets sprayed on everything.
Re: Moderna mRNA sequence released to GitHub [pdf]
#114Earlier quoted context omitted.
A pairwise sequence alignment done with `needle` starts like this: BioNTech_Pfiz 1 -----------GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAG 39 |||||.|.|..|||| ||| || Moderna 1 GGGAAATAAGAGAGAAAAGAAGAGTA----------------AGA---AG 31 BioNTech_Pfiz 40 AGAGA----AC-------CCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 78 |.|.| || |||||||||||||||||||||||||||||||| Moderna 32 AAATATAAGACCCCGGCGCCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 81 BioNTech_Pfiz 79 C…
Knowing nothing about biotech – if Moderna and Pfizer were working from the same sequencing data, why would their resulting vaccine mRNA sequences be different? Even slightly? Edit: I guess what I'm asking is: presumably these vaccines both target the spike protein. Do both of these sequences express the same protein? Or is there a "close enough!" thing in the immune system, where it can be a little different and sti…
This very cool article explains the mRNA sequence chunk-by-chunk which might give you a flavour of why differences exist: https://berthub.eu/articles/posts/reverse-engineering-source...
Re: Moderna mRNA sequence released to GitHub [pdf]
#115Earlier quoted context omitted.
> We aren’t that different from machines, we just need to know more about the CPU and all the co-processors and how the logic gates interact Except it is unfortunately not that simple, because it assumes that distinct components such as CPU, co-processors and even logic gates exist in that context, as is totally reasonable to assume on devices created by humans. Abstracting complex machines into distinct components i…
It is actually sort of strange how compartmentalized the living cell is. I guess there is some type of redundancy that comes from compartmentalization that is evolutionarily beneficial.
No doubt, and separate organs with (sometimes rough, sometimes very clear) separate functions are also a thing, so evolution seems to favor compartmentalization for more complex systems. But that does not mean that there are not complex overarching interactions that make full understanding really hard. The sort of interactions you would stay away from when designing a computer, not because it would not work, but because it would make design, debugging, and iteration upon your system prohibitively hard.
Re: Moderna mRNA sequence released to GitHub [pdf]
#116Earlier quoted context omitted.
A pairwise sequence alignment done with `needle` starts like this: BioNTech_Pfiz 1 -----------GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAG 39 |||||.|.|..|||| ||| || Moderna 1 GGGAAATAAGAGAGAAAAGAAGAGTA----------------AGA---AG 31 BioNTech_Pfiz 40 AGAGA----AC-------CCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 78 |.|.| || |||||||||||||||||||||||||||||||| Moderna 32 AAATATAAGACCCCGGCGCCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 81 BioNTech_Pfiz 79 C…
Knowing nothing about biotech – if Moderna and Pfizer were working from the same sequencing data, why would their resulting vaccine mRNA sequences be different? Even slightly? Edit: I guess what I'm asking is: presumably these vaccines both target the spike protein. Do both of these sequences express the same protein? Or is there a "close enough!" thing in the immune system, where it can be a little different and sti…
[deleted]
Re: Moderna mRNA sequence released to GitHub [pdf]
#117Earlier quoted context omitted.
A pairwise sequence alignment done with `needle` starts like this: BioNTech_Pfiz 1 -----------GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAG 39 |||||.|.|..|||| ||| || Moderna 1 GGGAAATAAGAGAGAAAAGAAGAGTA----------------AGA---AG 31 BioNTech_Pfiz 40 AGAGA----AC-------CCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 78 |.|.| || |||||||||||||||||||||||||||||||| Moderna 32 AAATATAAGACCCCGGCGCCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 81 BioNTech_Pfiz 79 C…
Knowing nothing about biotech – if Moderna and Pfizer were working from the same sequencing data, why would their resulting vaccine mRNA sequences be different? Even slightly? Edit: I guess what I'm asking is: presumably these vaccines both target the spike protein. Do both of these sequences express the same protein? Or is there a "close enough!" thing in the immune system, where it can be a little different and sti…
[deleted]
Re: Moderna mRNA sequence released to GitHub [pdf]
#118Earlier quoted context omitted.
A pairwise sequence alignment done with `needle` starts like this: BioNTech_Pfiz 1 -----------GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAG 39 |||||.|.|..|||| ||| || Moderna 1 GGGAAATAAGAGAGAAAAGAAGAGTA----------------AGA---AG 31 BioNTech_Pfiz 40 AGAGA----AC-------CCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 78 |.|.| || |||||||||||||||||||||||||||||||| Moderna 32 AAATATAAGACCCCGGCGCCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 81 BioNTech_Pfiz 79 C…
Knowing nothing about biotech – if Moderna and Pfizer were working from the same sequencing data, why would their resulting vaccine mRNA sequences be different? Even slightly? Edit: I guess what I'm asking is: presumably these vaccines both target the spike protein. Do both of these sequences express the same protein? Or is there a "close enough!" thing in the immune system, where it can be a little different and sti…
The sequence can be changed and optimized for several reasons:
* There are untranslated regions (UTR) that could influence the regulation or stability of the mRNA.
* Since most amino acids are encoded by more than codon, the coding region for the spike protein can be codon optimized. Altering the codon composition can improve protein expression.
* Likewise, enrichment of G:C content in the mRNA sequence might result in increased mRNA and expressed protein yields in vivo.
See https://www.nature.com/articles/nrd.2017.243#Sec4 for more information.
Edit:
> Do both of these sequences express the same protein?
In this case both vaccines express exactly the same amino acid sequence.
> Or is there a "close enough!" thing in the immune system, where it can be a little different and still be targeted by the immune system?
It depends on how different the sequence is. For instance, if it is a little different the immune response should be very similar because, for example, the three-dimensional conformation of the spike protein chain should remain very similar as well. This is why the vaccines can be effective against several SARS-CoV2 variants.
Re: Moderna mRNA sequence released to GitHub [pdf]
#119I'm sure it's more complex than I grasp as a layperson, but I'm utterly amazed at how simple this _appears_. I get the feeling that this is something I have a better chance of understanding than the average SaaS Terms and Conditions. I expected to have to scroll through pages upon pages of indecipherable text. Instead it's no bigger than a large paragraph of text, and I can easily fit it on my screen.
> and I can easily fit it on my screen. ...with GATACCA right in the middle, but unfortunately with no GATTACA that I could find.
Heh. Technically, there isn't even GATTACA in there since it's RNA and hence all the T's are actually U's. It's just convention to use the T's. GAUUACA doesn't have the same ring to it.
Re: Moderna mRNA sequence released to GitHub [pdf]
#120Earlier quoted context omitted.
Knowing nothing about biotech – if Moderna and Pfizer were working from the same sequencing data, why would their resulting vaccine mRNA sequences be different? Even slightly? Edit: I guess what I'm asking is: presumably these vaccines both target the spike protein. Do both of these sequences express the same protein? Or is there a "close enough!" thing in the immune system, where it can be a little different and sti…
This very cool article explains the mRNA sequence chunk-by-chunk which might give you a flavour of why differences exist: https://berthub.eu/articles/posts/reverse-engineering-source...
That is a super interesting article, thank you for posting it!
But, I guess my question is more about why the abstraction of "protein chunks" doesn't fall apart when there are relatively significant "diffs" in the RNA sequence.