Moderna mRNA sequence released to GitHub [pdf]

Post by azernik » Mon, Mar 29, 2021, 10:51 PM UTC

schoen wrote: post #81

azernik wrote: post #70

Earlier quoted context omitted.

The protein they're trying to manufacture is indeed quite simple - AFAIU both BioNTech and Moderna put together their sequences in a weekend. (Though there was a more involved process of winnowing down the sequences for the most effective ones.) The technically challenging parts are: - delivery mechanism: you need to take a very unstable molecule, protect it from the environment - both external, and when inside the p…

> Hence they feel safe releasing this. Their moat is not the gene sequence, their moat is everything else. One or more of the vaccine developers may have released such details, but this particular file is a reverse engineering effort by unaffiliated scientists based on analyzing the dregs of used vaccine vials (!). Edit: See https://news.ycombinator.com/item?id=26628594 for more substantive discussion about this.

Post by brian_herman » Mon, Mar 29, 2021, 10:51 PM UTC

flobosg wrote: post #46

brian_herman wrote: post #22

https://github.com/brianherman/Assemblies-of-putative-SARS-C... I posted some txt files with the lines removed and stuff.

If you have the time, it would be nice to transfer the data to the commonly used Genbank format.

Post by MauranKilom » Mon, Mar 29, 2021, 10:52 PM UTC

purple_ferret wrote: post #72

drtz wrote: post #31

I'm sure it's more complex than I grasp as a layperson, but I'm utterly amazed at how simple this _appears_. I get the feeling that this is something I have a better chance of understanding than the average SaaS Terms and Conditions. I expected to have to scroll through pages upon pages of indecipherable text. Instead it's no bigger than a large paragraph of text, and I can easily fit it on my screen.

Any individual protein doesn't seem that complex since it's just a combination of some 20 amino acids, but the variations are endless: "Since each of the 20 amino acids is chemically distinct and each can, in principle, occur at any position in a protein chain, there are 20 × 20 × 20 × 20 = 160,000 different possible polypeptide chains four amino acids long, or 20n different possible polypeptide chains n amino acids…

Post by atleta » Mon, Mar 29, 2021, 10:54 PM UTC

seiferteric wrote: post #54

tablespoon wrote: post #52

Earlier quoted context omitted.

> This is somewhat of a problem for our vaccine - it needs to sneak past our immune system. Over many years of experimentation, it was found that if the U in RNA is replaced by a slightly modified molecule, our immune system loses interest. For real. > So in the BioNTech/Pfizer vaccine, every U has been replaced by 1-methyl-3’-pseudouridylyl, denoted by Ψ. The really clever bit is that although this replacement Ψ pla…

Umm, isn't that kind of scary? Like could you create a virus with this Ψ that our immune system can't fight at all?

Post by type_enthusiast » Mon, Mar 29, 2021, 10:57 PM UTC

flobosg wrote: post #97

joeyh wrote: post #85

My first thought was `wdiff pdizer moderna`. It's short enough to post here in its entirity, but I guess I had better not, anyway it's easy enough to extract from the pdf. Add a space after every letter and wdiff can find the common sequences nicely. Short except for flavor, this is from near the beginning: A[-G-]AGA{+A+}GAA{+ATATAAGAC+}CCCG{+GCGCCG+}CCACCATGTTCGTGTTCCTGGTGCTGCTGCC[-T-]{+C+}

A pairwise sequence alignment done with `needle` starts like this: BioNTech_Pfiz 1 -----------GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAG 39 |||||.|.|..|||| ||| || Moderna 1 GGGAAATAAGAGAGAAAAGAAGAGTA----------------AGA---AG 31 BioNTech_Pfiz 40 AGAGA----AC-------CCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 78 |.|.| || |||||||||||||||||||||||||||||||| Moderna 32 AAATATAAGACCCCGGCGCCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 81 BioNTech_Pfiz 79 C…